0 item(s)
View cart
You have no items in your shopping cart.
Description
SHENTEK® rcAAV Quantitation Kit is suitable for qPCR detection of replication-competent adeno-associated virus (rcAAV) from cell culture harvested bulk and purified stock. This rcAAV-5/N Quantitation Kit is designed for the quantification of rcAAV-5/N contamination in serotypes of rAAV-5/N (N stands for possible different capsid serotypes). The sample types include but are not limited to recombinant adeno-associated virus (rAAV) bulk and end-products, as well as harvested samples from cell culture desired for rcAAV detection.
Key information before using this kit:
1. AAV serotypes
2. The inverted terminal repeat (ITR) sequence of the test sample rAAV need to match the following sequences:
ITR sequence of rAAV-5/N
CTCTCCCCCCTGTCGCGTTCGCTCGCTCGCTGGCTCGTTTGGGGGGGTGG
CAGCTCAAAGAGCTGCCAGACGACGGCCCTCTGGCCGTCGCCCCCCCAA
ACGAGCCAGCGAGCGAGCGAACGCGACAGGGGGGAGAGTGCCACACTC
TCAAGCAAGGGGGT
Overview
| Components | Shipping Condition | Unit Size | Detection Method |
| T & R DNA Control - 5 | -20℃ | 100 reactions × 2 | Probe-based qPCR |
| rcAAV qPCR Reaction Buffer | -20℃, protect from light | ||
| Target Primer&Probe MIX-5 | |||
| Reference Primer&Probe MIX-5 | |||
| 100×ROX | |||
| DNA Dilution Buffer (DDB) | |||
| ddH2O | -20℃ |
Specification
| Range | Target-5: 2 - 2×106 copies/μL, R2= 0.999，E=95.3% |
| Reference-5: 2 - 2×106 copies/μL, R2= 0.999，E=94.8% | |
| Accuracy | Target-5: Recovery = 105.2%-123.7%, CV<30% |
| Reference-5: Recovery = 93.5%-121.5%, CV<30% | |
| LOQ | Target-5: 2 copies/μL |
| Reference-5: 2 copies/μL | |
| LOD | Target-5: 4×10-1 copies/μL |
| Precision | Target-5: 7.1%-8.2% (≤20%) |
| Reference-5: 6.5%-9.8% (≤20%) | |
| Robustness | Freeze-thaw stability over 5 cycles |
| Instrument suitability not limited to Thermo, Biorad, Roche, SHENTEK qPCR equipments |
Documents
Related Products
SHENTEK® Virus DNA & RNA Extraction Kit
SHENTEK® rcAAV-2/N Quantitation Kit
Research Use Only
✔
For Research Use Only (RUO) – This product is intended for laboratory research purposes only and not for clinical or regulatory diagnostic use.
✔
Not intended for use in USDA or FDA regulated diagnostic testing or official compliance testing.
When can I expect my order to ship?
Most orders are filled and shipped within 2-3 business days from the time they are received.
Our standard shipping usually take 2-5 days.
We also provide express shippping for time-sensitive deliveries.
Email contact@biofargo.com if you have any requirements.
