0 item(s)
View cart
You have no items in your shopping cart.
$423.00
Sku: 12330ES01
Availability:
AVAILABLE
In stock & estimated to ship in 3-7 days by June 13, 2026
Description
Stubby UDI Primer Kit for Illumina is a dedicated linker kit for library construction on the Illumina high-throughput sequencing platform, including PE Adapter and UDI Primer used in next-generation sequencing library construction. The UDI Primer is a master mix of i5 and i7 Primer used with the DNA Library Prep Kit for Illumina, and 12327-12330 are available in plate packs with 96 indexes each, allowing the construction of up to 384 double-ended unique Index-labeled libraries. All reagents provided in the kit undergo rigorous quality control and functional verification to maximize library construction stability and repeatability.
Components
| No. | Name | 96 × 1 T | 96 × 2 T | 96 × 4 T |
| 12327 | PE Adapter | 336 μL | 672 μL | 2 × 672 μL |
| UDI Primer 001–096 | 5 μL each | 10 μL each | 20 μL each | |
| 12328 | PE Adapter | 336 μL | 672 μL | 2 × 672 μL |
| UDI Primer 097–192 | 5 μL each | 10 μL each | 20 μL each | |
| 12329 | PE Adapter | 336 μL | 672 μL | 2 × 672 μL |
| UDI Primer 193–288 | 5 μL each | 10 μL each | 20 μL each | |
| 12330 | PE Adapter | 336 μL | 672 μL | 2 × 672 μL |
| UDI Primer 289–384 | 5 μL each | 10 μL each | 20 μL each |
Shipping and Storage
All the components are shipped with dry ice and can be stored at -15℃~ -25℃ for 2 years.
Note
-
The concentration of PE Adapter in this kit is 15 μM, and the amount of linker used for individual library construction is adjusted according to the kit used.
-
The PE Adapter provided with this kit is a general-purpose short adapter that requires PCR amplification to obtain a complete library.
-
UDI Primer provides Index sequence tags at a concentration of 12.5 μM for sample differentiation during high-throughput sequencing.
-
Do not heat the adaptors, let it dissolve slowly at room temperature, and the laboratory temperature is best set to 20-25 °C. It is recommended to store it in aliquots avoiding repeated freeze-thaw and store it at 4°C for a short time.
-
The DNA library structure using the Hieff NGS® Stubby UDI Primer Kit for Illumina® kit is as follows:
-
For your safety and health, please wear a lab coat and wear disposable gloves.
-
This product is for scientific research purposes only!
Sequence information
PE Adapter for Illumina：
5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGT*C-3´
5´-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´
i5 Index Primer for Illumina：
5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´
i7 Index Primer for Illumina：
5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´
[i5 Index] 8 bp i5 sequence，[i7 Index]8 bp i7 sequenceThe corresponding locations of each primer in 96-well plate are shown:‘’
Documents
When can I expect my order to ship?
Most orders are filled and shipped within 2-3 business days from the time they are received.
Our standard shipping usually take 2-5 days.
We also provide express shippping for time-sensitive deliveries.
Email contact@biofargo.com if you have any requirements.
