0 item(s)
View cart
You have no items in your shopping cart.
$68.16
Sku: DTM-101
Availability:
AVAILABLE
In stock & estimated to ship in 3-7 days by June 13, 2026
Description
Quick Taq™ HS DyeMix is a Taq-based 2x master mix PCR reagent that contains an electrophoresis dye (BPB; bromophenol blue) and anti-Taq antibodies for hot start PCR. This reagent contains all components for PCR except primers and template DNA. This reagent shows specific and efficient amplification. The amplified products can be directly loaded in the wells of agarose or acrylamide gels.
Features
- • Contains bromophenol blue (BPB) as an electrophoresis dye; PCR products can be directly analyzed on gels.
- • Enables greater PCR performance than conventional Taq DNA polymerase.
- • Contains anti-Taq antibodies for hot start PCR, ensuring high specificity and sensitivity.
- • Stable for at least three months at 4ºC and tolerant to multiple freeze-thaw cycles.
Application
-
General PCR
-
Colony direct PCR
Specification
| Category | Item | Details |
|---|---|---|
| Storage condition | - | Store at -20ºC |
Components
This reagent includes the following components for 100 reactions, 50 µL total reaction volume:
| Item | Details |
|---|---|
| 2x Quick Taq™ HS DyeMix | 1.25 mL × 2 |
*In the case of long-term storage (>3 months), this reagent should be stored at -20ºC.
Typical PCR Reaction Setup
| Component | Volume | Final Concentration |
|---|---|---|
| Quick Taq™ HS DyeMix | 25 µL | 1× |
| 10 pmol/µL Primer #1 | 1.0 µL | 0.2 µM |
| 10 pmol/µL Primer #2 | 1.0 µL | 0.2 µM |
| Template DNA | X µL | Genomic DNA ≤ 200 ng/50 µL Plasmid DNA ≤ 50 ng/50 µL Colony |
| PCR grade water | Y µL | - |
| Total reaction volume | 50 µL | - |
* Do not use dNTPs from other kits or companies.
PCR Cycle Conditions
We recommend trying 3-step cycles when the Tm of primers is under 73ºC.
Application Data
Example 1.Amplification of the human p53 genes (2.9 kb)
The human p53 genes (2.9 kb) was amplified using 50 ng of human genomic DNA. Quick Taq™ HS DyeMix successfully amplified the targets.
M: 1 kb Ladder
1: Quick Taq™ HS DyeMix
2: rTaq DNA polymerase (hot start)
3: rTaq DNA polymerase
4: Taq Master Mix (Company A)
Template: Human genomic DNA 50 ng / 50 µL reaction
Forward Primer: AATGGATGATTTGATGCTGTCCC
Reverse Primer: ATAAGAGCTCCCAAGACTTAG
*Final concentration 0.2 µM
Example 2.Insert amplification by a colony-direct PCR
The inserts were amplified using Quick Taq™ HS DyeMix with universal primers from E. coli DH5α colonies bearing pTA2 plasmid (insert size: 500 bp). Quick Taq™ HS DyeMix successfully and efficiently amplified all targets.
M: 100 bp Ladder Markers
1: Colony (insert +)
2: Colony (insert -)
3: Colony (insert +)
4: Colony (insert +)
5: Colony (insert +)
N: Negative Control
M: 100 bp Ladder Marker
Forward Primer: CGCCAGGTTTTCCCAGTCACGAC
Reverse Primer: AGCGGATAACAATTTCACACAGGAAAC
*Final concentration 0.2 µM
Documents
When can I expect my order to ship?
Most orders are filled and shipped within 2-3 business days from the time they are received.
Our standard shipping usually take 2-5 days.
We also provide express shippping for time-sensitive deliveries.
Email contact@biofargo.com if you have any requirements.
