$250.32

FREE
SHIPPING

100% MONEY
BACK GUARANTEE

ONLINE
SUPPORT 24/7

Sku: KMM-201
Tags:
Availability:
AVAILABLE
In stock & estimated to ship in 3-7 days by May 12, 2026

Description

KOD One™ PCR master Mix and KOD One™ PCR Master Mix -Blue- are 2 x PCR master mixes based on genetically modified KOD DNA polymerase (UKOD). KOD One™ series enables fast PCR, which has an extension time of 5 sec/ kb by applying UKOD and a new Elongation Accelerator. In addition, these master mixes provide greater efficiency and elongation capabilities than conventional PCR enzymes. In particular, these show greater amplification success from crude specimens. Furthermore, these master mixes can be applied to amplify from templates containing uracils (dU) or using primers containing inosines (dI) and uracils (dU).

KOD One™ series contains two types of anti-KOD DNA polymerase antibodies that inhibit the polymerase and 3’→5’ exonuclease activities, thus allowing for Hot Start PCR. These master mixes generate blunt-end PCR products because of 3’ → 5’ exonuclease (proof-reading) activity of KOD DNA polymerase.

Features

  • Fast
    KOD OneTM series can amplify the targets using the following very short conditions:

≤1 kb: 1 sec
1~ 10 kb: 5 sec/ kb
10 kb~: 10 sec/ kb

The cycling conditions can be set flexibly when various targets having different sizes are amplified.

  • Easy to Use
    KOD OneTM series contains all reaction components except primers and templates and provide high reproducibility by reducing operations. In addition, KOD OneTM PCR Master Mix -Blue- includes a loading dye (BPB) to allow direct loading onto agarose gels.
  • High Fidelity
    KOD OneTM series exhibits approximately 80-fold higher fidelity than Taq DNA polymerase. These mixes can be used for various purposes where this would be an advantage (e.g., in the preparation of long target amplicons for sequencing).
  • High Efficiency
    KOD OneTM series is effective for amplification from crude samples (e.g., biological samples, foodstuffs, soil extract, etc.). Various samples or lysates can be used directly as templates.
  • Primers or Templates Containing Inosines (dI) or Uracils (dU) Can Be Used
    KOD OneTM series can use primers or templates containing inosines (dI) or uracils (dU), whereas conventional high-fidelity PCR enzymes cannot.

Application

  • Direct PCR

  • Colony PCR

  • Amplification of NGS libraries

  • Site direct gene mutation

Specification

Category Item Details
Source - E. coli strain carrying the cloned UKOD DNA polymerase gene
Storage condition - Store at -20°C ( 4°C for a month )

Components

KOD OneTM series include the following components for 200 reactions, 50 μl total reaction volume.

KMM-101 Details
KOD OneTM PCR master Mix 1 mL x 5
KMM-201 Details
KOD OneTM PCR master Mix -Blue- 1 mL x 5

Note
The reagents can be stored at 4°C for a month. For longer storage, the reagents should be kept at -20°C.

Application Data

Example 1.Fast PCR

Various targets were amplified with KOD OneTM PCR Master Mix and KOD OneTM PCR Master Mix -Blue- using the ultra fast cycling conditions. KOD OneTM series successfully amplified all targets.

Reaction Mix

PCR cycle

Example 2.Amplification from cDNA

Inhibitory effect of RNA in cDNA was compared using various PCR enzymes. KOD OneTM Master Mix was not susceptible to RNA inhibition, and it was able to amplify targets under high concentrations of cDNA.

Reaction Mix

PCR cycle

Example 3.PCR error ratio

The error ratio of various PCR enzymes were compared by determining the sequences of the amplicons from human β-globin gene. The amplicons were cloned into the vector using TArget cloneTM -Plus- (Code No. TAK-201) and the sequences were determined.
KOD OneTM PCR Master Mix and KOD OneTM PCR Master Mix -Blue- showed excellent fidelity and the mutation frequency were approximately 80 times lower than Taq DNA polymerase.

Example 4.Amplification using degenerate primers, containing inosine(I)

The 2.8 kb fragments were amplified using degenerate primers containing inosine(I). KOD OneTM PCR Master Mix was able to amplified, whereas conventional high-fidelity PCR enzymes cannot.

Reaction Mix

PCR cycle

Primer sequence

Fwd: ATGGTICARATHCCICARAAY
Rev: RTGIGCYTGRTCCCARTTYTC

Example 5.Amplification from crude samples

Amplification from whole blood and that from mouse lysate were compared. KOD OneTM PCR Master Mix amplified the targets efficiently.

Reaction Mix

PCR cycle

Example 6.Amplification of NGS library -Minimal amplification bias-

A NGS library of Thermus thermophilus genome (GC content 70%) was amplified using KOD OneTM PCR Master Mix and another company's product, and the amplified libraries were sequenced on an Illumina MiSeq. This is the result of examining the GC bias of amplified libraries. The Normalized Coverages (Blue plot) close to 1 indicate low bias. KOD OneTM PCR Master Mix showed the lower GC bias than another company's product.

Reaction Mix

PCR cycle

Primer sequence

Fwd: AATGATACGGCGACCACCGAGATC
Rev: CAAGCAGAAGACGGCATACGAG

Please see below for library input amounts and cycle numbers.
(The optimal number of cycles may vary from 1 to 3 cycles depending on the sample type and mold size distribution.)

library input amount number of cycle
1 μg 0 - 1
500 ng 1 - 2
100 ng 4 - 5
50 ng 5 - 6
10 ng 8 - 10
1 ng 13 - 15
0.25 ng 16 - 18

When can I expect my order to ship?

Most orders are filled and shipped within 2-3 business days from the time they are received.

Our standard shipping usually take 2-5 days.

We also provide express shippping for time-sensitive deliveries. 

Email contact@biofargo.com if you have any requirements.

 

Terms and Conditions