Description

Quick Taq™ HS DyeMix is a Taq-based 2x master mix PCR reagent that contains an electrophoresis dye (BPB; bromophenol blue) and anti-Taq antibodies for hot start PCR. This reagent contains all components for PCR except primers and template DNA. This reagent shows specific and efficient amplification. The amplified products can be directly loaded in the wells of agarose or acrylamide gels.

Features

• Contains bromophenol blue (BPB) as an electrophoresis dye; PCR products can be directly analyzed on gels.
• Enables greater PCR performance than conventional Taq DNA polymerase.
• Contains anti-Taq antibodies for hot start PCR, ensuring high specificity and sensitivity.
• Stable for at least three months at 4ºC and tolerant to multiple freeze-thaw cycles.

Application

General PCR
Colony direct PCR

Specification

Category	Item	Details
Storage condition	-	Store at -20ºC

Components

This reagent includes the following components for 100 reactions, 50 µL total reaction volume:

Item	Details
2x Quick Taq™ HS DyeMix	1.25 mL × 2

*In the case of long-term storage (>3 months), this reagent should be stored at -20ºC.

Typical PCR Reaction Setup

Component	Volume	Final Concentration
Quick Taq™ HS DyeMix	25 µL	1×
10 pmol/µL Primer #1	1.0 µL	0.2 µM
10 pmol/µL Primer #2	1.0 µL	0.2 µM
Template DNA	X µL	Genomic DNA ≤ 200 ng/50 µL Plasmid DNA ≤ 50 ng/50 µL Colony
PCR grade water	Y µL	-
Total reaction volume	50 µL	-

* Do not use dNTPs from other kits or companies.

PCR Cycle Conditions

We recommend trying 3-step cycles when the Tm of primers is under 73ºC.

Application Data

Example 1.Amplification of the human p53 genes (2.9 kb)

The human p53 genes (2.9 kb) was amplified using 50 ng of human genomic DNA. Quick Taq™ HS DyeMix successfully amplified the targets.

M: 1 kb Ladder
1: Quick Taq™ HS DyeMix
2: rTaq DNA polymerase (hot start)
3: rTaq DNA polymerase
4: Taq Master Mix (Company A)

Template: Human genomic DNA 50 ng / 50 µL reaction
Forward Primer: AATGGATGATTTGATGCTGTCCC
Reverse Primer: ATAAGAGCTCCCAAGACTTAG
*Final concentration 0.2 µM

Example 2.Insert amplification by a colony-direct PCR

The inserts were amplified using Quick Taq™ HS DyeMix with universal primers from E. coli DH5α colonies bearing pTA2 plasmid (insert size: 500 bp). Quick Taq™ HS DyeMix successfully and efficiently amplified all targets.

M: 100 bp Ladder Markers
1: Colony (insert +)
2: Colony (insert -)
3: Colony (insert +)
4: Colony (insert +)
5: Colony (insert +)
N: Negative Control
M: 100 bp Ladder Marker

Forward Primer: CGCCAGGTTTTCCCAGTCACGAC
Reverse Primer: AGCGGATAACAATTTCACACAGGAAAC
*Final concentration 0.2 µM

Documents

Download Manual Download SDS Request COA

Quick Taq HS DyeMix-Toyobo